Janice K.

Fall 2012
Week 13
Inhibition Assay FtHAP (Second Attempt) Compound 5154121

For the second run, the concentration of the diluted enzyme was kept the same, but only 22.5 ul of the enzyme in Tris-acetate instead of 30 ul. The absorbance lowered so the spectrophotometer can give a better reading. As seen in the Excel graph, the absorbance measured displayed decreasing absorbance as the concentration of the inhibitor increased. This inhibition assay demonstrates a possibility of the compound effectively inhibiting the FtHAP_DXR. In order to confirm the findings, more inhibition assays should be completed.

Figure 2: Inhibition Assay- Absorbance at 420 nm vs Inhibitor Concentration (um) for FtHAP second run

Figure 1: Inhibition Assay- Absorbance at 420 nm vs Inhibitor Concentration (uM) for FtHAP first run
-Completed first run for CB_kin library
Enzyme Assay FtHAP (First Attempt) Compound 5154121

The graph was supposed to show steady increase in absorbance as the concentration of the enzyme were raised. Although the last two measurements at high enzyme concentration displayed significantly higher absorbance, the data points did not show any pattern. The sources of error may have wrong dilutions of NaOH and stock enzyme. Moreover, wrong measurements of the reagents added may have caused the sporadic pattern. This experiment will need to be repeated before continuing on the inhibition assay.


Figure 3: Absorbance at 420 nm vs Enzyme Concentration (uM) for FtHAP

Figure 2: Average of readings (no enzyme subtracted) at various enzyme concentrations for FtHAP

Figure 1: Absorbance measured at 420 nm for FtHAP with various enzyme concentrations

-DNA sequencing result for FrTu_DXR

• came back with just pNIC-Bsa4 vector sequence or tons of N's

-reconcentrated to 1.00 mL of FtHAP after FPLC
-added glycerol & stored at -20C
Nanodrop result for FtHAP after reconcentration



The nanodrop results for FtHAP after reconcentration were measured at 2.26 and 2.25 mg/mL.
Nanodrop result for FtHAP before reconcentration


The nanodrop result for FtHAP before reconcentration was measured at 0.47 mg/ml after FPLC.
Fast Protein Liquid Chromatography (FPLC) Result for FtHAP


The FPLC showed that tubes 32-38 contained the FtHAP protein.. The buffer used for the process contained 100 mM Tris, 150 mM NaCl, pH 8.0. The absorbance was measured at 280 nm. After initial concentration, there were 1.00 mL of FtHAP used for FPLC. The initial data collection demonstrated a carry over from the previous FPLC with another protein, but it stabilizes soon as the buffer runs through the machine. The large bump may or may not located at the right size, but it was determined to be close enough to continue. The second bump out of the three represents the location of the target protein.These selected tubes were saved and reconcentrated to 1.00 mL. Glycerol was added to the sample and stored at -20C.

Week 12
112612 - Good. Dr B

-concentrated Elution #1 & FPLC 11/20/2012
-Protein Characterization for FtHAP (will dry gel later)
-prepared samples for DNA sequencing to check for positive clones 11/19/2012
Nanodrop Result after Protein Purification FtHAP with Sadhana's Protocol

Protein Purification Elution #1 Nanodrop Reading measured at 1.78 mg/ml (FtHAP in BL21 (DE3))

Protein Purification Elution #1 Nanodrop Reading measured at 0.25 mg/ml (FtHAP in BL21 (DE3))

Nanodrop Result after Miniprep for FrTu_DXR (First Attempt)

Nanodrop result after miniprep measured at 103.0 ng/nL (FrTu_DXR Sample 1)

Nanodrop result after miniprep measured at 124.1 ng/uL (FrTu_DXR Sample 2)

Nanodrop result after miniprep measured at 91.3 ng/uL (FrTu_DXR Sample 3)

Nanodrop result after miniprep measured at 90.8 ng/uL (FrTu_DXR Sample 4)

Nanodrop result after miniprep measured at 319.7 ng/uL (FrTu_DXR Sample 5)

Nanodrop result after miniprep measured at 77.1 ng/uL (FrTu_DXR Sample 6)

Nanodrop result after miniprep measured at 92.8 ng/uL (FrTu_DXR Sample 7)

Nanodrop result after miniprep measured at ng/uL (FrTu_DXR Sample 8)
Week 11
Good - Dr. B 11/19/12
-growing FtHAP with Sadhana's protocol
-Spun down 8 samples after 16 hours of growth & moved master plate from 4C to -20C (11/13/2012) at 11 am
-Picked 8 colonies to grow for 16 hours & made master plate (11/12/12) 7 pm
-Attempted cloning for FrTu_DXR (11/10/12) will check plates on Monday

Francisella Tularensis_DXR transformation plate #1 (3ul of Accepting + 10 ul of PCR insert)

Francisella Tularensis_DXR transformation plate #2 (5ul of Accepting + 5 ul of PCR insert)

Francisella Tularensis_DXR transformation plate #3 (5ul of Accepting + 7 ul of PCR insert)

I picked two colonies from each plate to make the master plate. There were little bit more colonies present on the plates than targeted 20 colonies. After letting it grow for 16 hours, the samples were spun down. The master plate was moved to 4C while the 8 samples are now stored in -20C. The midiprep kit will be used to extract and purify the DNA. I am hoping to the send the samples to DNA sequencing by Friday.

Although my transformation plates did not previously grow during my first two attempts, I accidentally left my pNIC-Bsa4 + PCR insert + DH5alpha sample in the 37C shaking incubator for 2.5 hours instead of 1 hour. I was worried that it might have overgrown, but I was able to see growth on my transformation plate. Although I am a little skeptical about my plates, I will continue on to identifying the positive clone.

Secondary PCR WBM_DXR (First Attempt)

Lane 2: 100 bp ladder
Lane 3-10: Secondary PCR for WBM_DXR

Although my primary PCR for WBM worked, I'm not sure why I have smear bands rather than bright bands for my secondary PCR samples. I might just continue to PCR squared to see what is going on. It also might have been the gel since my 100 bp ladder looks smeared. I might try adjusting the annealing temperature to see how the change affects my samples.

-Homology model prepared for virtual screening using Hermes
-First virtual screening run using homology model for FrTu with cb_306
-Made oligo mix for WBM_DXR

Primary PCR WBM_DXR (First Attempt)

Lane 2: 100 bp ladder
Lane 3,5,7,9- Primary PCR

I used 58C for the annealing temperature for the primary PCR for WBM. I think this temperature works perfectly since I got bright smears on the gel. I will continue on with Primary PCR #1 to make my secondary PCR samples.

Week 10
Cut pNIC-Bsa4

Lane 2: 1kb ladder
Lane 4: cut pNIC-Bsa4 (NEB)
Lane 6: cut pNIC-Bsa4 (Fermentas)

I just threw these samples away due to the extra bands. I think there is something wrong with my stock pNIC-Bsa4.
I am making more using the staff pNIC-Bsa4.
Homology Model


Modeled Residue Range: 2 to 385
Template: 3IIEA
Sequence Identity: 45.844
QMEAN Z-Score: -1.994
QMEANscore4: 0.645

Primer Sequence
FOR: 5'- TAC TTC CAA TCC ATG TTC AAA AAA ACC-3'
REV: 5'- TAT CCA CCT TTA CTG TTA GCC CAG AA-3'
Primers for Plate

Cut pNIC-Bsa4 used ECO311

Lane 2: 1kb ladder
Lane 4: cut pNIC-Bsa4
Lane 6: cut pNIC-Bsa4
PCR^2

Figure 1: Nanodrop result of PCR^2 eluted in 50ul of elution solution measured at 86.4 ng/ul

Figure 2: Nanodrop result of PCR^2 eluted in 50ul of elution solution measured at 83.7 ng/ul

Figure 3: PCR^2 Gel Check
Lane 2: 100bp ladder
Lane 3-10: PCR^2 samples

I started my cohesive end generation for PCR insert and accepting vector. After I placed the samples in the heat block, the temperature was little bit lower than the target temperature. I turned the knob slightly to adjust the temperature, but I ended up overshooting. When I came back to retrieve my samples, they were all evaporated (even though I placed another block on top of the lids). :( I ran out of my PCR^2 so I am making more for cloning.

Cut pNIC-Bsa4 used ECO311 (made from last weekend) Gel Check (Threw it away)

Lane 2: 100bp ladder
Lane 4: cut pNIC-Bsa4 from last weekend
Lane 6: cut pNIC-Bsa4 from last weekend

I gel checked the cut pNIC-Bsa4 that I made from last weekend. Although the concentration was measured around 67.6ng/ul, there was a smear on top of the two lines. I ended up just throwing it away and made new cut pNIC-Bsa4 for tomorrow (Sunday). I also used the wrong ladder for the gel so I will make sure to use 1kb ladder next time.

102112 - Janice, be sure to use the newer T4 DNA Polymeraase and the newer tubes of dGTP and dCTP. Also, if you want to team up with Aldo and split the work some - you may be able to move faster. - Dr. B

Week 9 (10/15/2012-10/20/2012)
I tried cloning twice this week, but nothing ended up growing on the transformation plates. I used the 37C shaking incubator in Welch for the cohesive end generation of PCR inserts and accepting vector. I also used the same Kan+Suc plate made by someone else from 8/28/2012 so I am considering on making my own or using plates that were made more recently.

Making more cut pNIC-Bsa4 and PCR fragment for next week
-will gel check my cut pNIC-Bsa4 on Monday (ran out of time on Saturday)
Nanodrop results for PCR^2 samples

Figure 1: Concentration of PCR^2 after clean up measured at 67.6 ng/ul

Figure 2: Concentration of PCR^2 after clean up measured at 66.0 ng/ul

Mixing the binding solution along with the samples in a separate tube before transferring it to the PCR clean tubes for the spin down slightly raised my concentrations since I used the same secondary PCR sample to make the PCR^2 last week.
Gel Check for PCR^2 samples

Lane 2: 100 bp ladder?
Lane 3-10: PCR^2 samples

The 100 bp ladder did not show up on the gel. I remember taking out & returning the 100bp ladder back to the -20C, but I think I may have forgotten to actually use it. :) I was pretty sure it was the right size since I used the same secondary PCR sample for my previously PCR^2. There was no apparent contamination from the gel.

Week 8/9 (10/13/2012-)
101612 - Janice, looks good. Good luck with the cloning steps! -- Dr. B
Next week:
-continue to Cohesive End Generation on PCR inserts and Accepting Vector
-start on homology model (?)
Cut pNIC-Bsa4 (First Attempt) WORKED!!!!!

Lane 2: 1kb ladder
Lane 4: cut pNIC-Bsa4

Nanodrop Result for Cut pNIC-Bsa4


I changed the final volume to 50 ul. I also doubled all the required reagents. In order to have 2250ng of pNIC-Bsa4 plasmid, I added 41.74 ul of pNIC-Bsa4 sample. The sample was placed in 37°Cwater bath for three hours. During the PCR clean up, I accidentally eluted the cut pNIC-Bsa4 in 50 ul of elution solution instead of 30ul. This might be the reason why the concentration came out on a little low side.

Week 8 (10/8/2012-10/13/2012)
100912 - Janice - GREAT JOB - We have new T4 DNA Poly that may work better for your cloning (new dGTP and new dCTP also) - Dr. B

Nandrop Result for PCR^2 WORKED!!!

Figure 1: Concentration of PCR^2 measured at 65.4 ng/uL

Figure 2: Concentration of PCR^2 measured at 65.9 ng/uL
The
PCR^2 (Third Attempt) using only Secondary PCR #1

Lane 2: 100bp ladder
Lane 3-10: PCR^2 from Secondary PCR #1

The concentration of PCR^2 previously came out really low since I eluted with the wrong amount. I started from the primary PCR (#2) to make secondary PCR (#1). Then, I used the Secondary PCR (#1) to make PCR^2 samples. When I eluted in 50ul of elution solution for PCR clean up, the concentration of PCR^2 came out within range (65.9ng/uL).


Week 7
PCR^2 (Third Attempt) using only Secondary PCR #1
dropped my gel :(
will gel check it again on Monday
Secondary PCR (Second Attempt)

Lane 2: 100bp ladder
Lane 3: Secondary PCR #1(red)
Lane 4: Secondary PCR #2 (red)
Lane 5: Secondary PCR #3 (red)
Lane 6: Secondary PCR #4 (red)
Lane 7: Secondary PCR #1 (blue)
Lane 8: Secondary PCR #2 (blue)
Lane 9: Secondary PCR #3(blue)
Lane 10: Secondary PCR #4(blue)
*made from Primary PCR #2 (orange)

pNIC-Bsa4 DNA Sequencing Analysis
The pNIC-Bsa4 vector (53.9 ng/ul) was blasted with the pNIC-Bsa4 FASTA sequence from Google Docs. I first took off some unnecessary N's from the beginning and end before comparing the sequences. Both the forward and reverse shows similarity to the original. However, there were some deletions noticeable. I am not sure whether the vector is still useable.
Forward pNIC-Bsa4

Query coverage: 92%
Max ident: 99%
Reverse pNIC-Bsa4

Query coverage: 91%
Max ident: 99%
-pNIC-Bsa4 vector sent to DNA sequencing- 10/02/2012
Week 6
PCR^2 Nanodrop Results (2nd Attempt)


100112 - Janice hmmm - not sure what is going on with PCR cleanup. Can't remember is you said you thought you knew. Hopefully better luck next time. - Dr. B
Week 5**
Made pNIC-Bsa4 vector & new PCR^2

• Will continue to PCR cleanup
• Need to sequence pNIC-Bsa4

Making pNIC-Bsa4 vector for cloning

I think the concentration of the pNIC-Bsa4 vector is high enough for cloning.
PCR^2 (Second Attempt)


Lane 2: 100bp ladder
Lane 3: PCR^2 for Secondary PCR #1
Lane 4: PCR^2 for Secondary PCR #1
Lane 5: PCR^2 for Secondary PCR #1
Lane 6: PCR^2 for Secondary PCR #1
Lane 7: PCR^2 for Secondary PCR #2
Lane 8: PCR^2 for Secondary PCR #2
Lane 9: PCR^2 for Secondary PCR #2
Lane 10: PCR^2 for Secondary PCR#2
Nanodrop Results for both PCR^2

The concentration of both samples were really low (8.8ng/ul and 7.2ng/ul).
I already remade the PCR^2 samples from Secondary PCR #1 and #2.
For next week, I will clean the samples up and measure the concentration again.

PCR^2 (First Attempt): Proceeded to PCR Cleanup for Both PCR^2 samples

Week 4- Janice, nice job! Be sure to make enough that you will have lots for cloning -- DR. B
Finished working on Virtual Screening due on Friday
Will be moving onto PCR^2 using Secondary PCR #1 and Secondary PCR #2

• PCR^2 made on Thursday
• Will gel check the samples next week

Secondary PCR (First Attempt) WORKED!!! 9/20/2012

Lane 2: 100bp
Lane 3: Secondary PCR #1 (Primary PCR #2)
Lane 4: Secondary PCR #2 (Primary PCR #4)
Lane 5: Secondary PCR #3 (Primary PCR #2)
Lane 6: Secondary PCR #4 (Primary PCR #4)
Lane 8-10: Max's samples

Bands are located around ~1100 & matches my gene size
Secondary PCR #1 &2 were placed in a different thermocycler than Secondary PCR #3 & #4.
The new thermocycler that I am using seems to bring out brighter bands even though I am using the same time and temperature from the PCR protocol.
Primary PCR (Fourth Attempt) WORKED!!! 9/18/2012

Lane 2: 100bp ladder
Lane 3: Primary PCR #1 (red tubes)-Janice
Lane 5: Primary PCR #2 (orange tubes)
Lane 6: Primary PCR #3(yellow tubes)
Lane 7: Primary PCR #4 (pink tubes)
Lane 9: PCR^2-Aldo

Week 3-
Janice - is this with KOD or Q5? KOD
Why do you think it is failing? I started using a different thermocycler. Now, it works better.
What will you try next to make it work? I think making multiple samples of primary PCR helped since it increased my chances of having at least one working.
- Dr. B 091812

Primary and Secondary PCR (Third Attempt)

Lane 2: 1kb ladder
Lane 3: Primary PCR
Lane 4: Primary PCR
Lane 6: Secondary PCR
Lane 8: Secondary PCR

Primary PCR with Q5 (Second Attempt)

Lane 2- 1kb ladder
Lane 3- Primary PCR- Aldo
Lane 5 & 6- Primary PCR- Janice

Week 2- Making new oligo mix

Week 1- Finished PyMol refresher (posted on Google Docs)
Primary & Secondary PCR (First Attempt)

Lane 2- 100bp ladder
Lane 4- Primary PCR
Lane 6- Secondary PCR

---

Summer 2012
pNIC-Bsa4 cloning (Second Attempt)

Lane 1: Skipped
Lane 2: 1kb ladder
Lane 3: pNIC-Bsa4 accepting vector- Janice
Lane 4:Skipped
Lane 5: pNIC-Bsa4 accepting vector- Aldo

pNIC-Bsa4 sample after clean up

Choosing Restriction Enzyme for FtDXR_pNIC-Bsa4



Protein Purification Nanodrop Results

Elution #1

Elution #1

Elution #2

Elution #2
pNIC-Bsa4 Cloning Miniprep Results

Sample 1: pNIC-Bsa4 cloning Mini Prep

Sample 2: pNIC-Bsa4 cloning Mini Prep

Sample 3: pNIC-Bsa4 cloning Mini Prep

Sample 4: pNIC-Bsa4 cloning Mini Prep

Sample 5: pNIC-Bsa4 cloning Mini Prep

Sample 6: pNIC-Bsa4 cloning Mini Prep

Sample 7: pNIC-Bsa4 cloning Mini Prep

Sample 8: pNIC-Bsa4 cloning Mini Prep
pNIC-Bsa4

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Wrong Sample
Lane 4: pNIC-Bsa4- Priya
Lane 5: PCR^2
Lane 6: PCR^2
Lane 7: PCR^2
Lane 8: PCR^2
Lane 9: pNIC-Bsa4-Janice

pNIC-Bsa4 sample after clean up
Midi Prep
Second Attempt


Midi Prep result for pNIC-Bsa4 grown in LB+Kan reading at 33.6 ng/uL and 32.6ng/uL
Average:33.1 ng/ul

First Attempt

Midi Prep result for pNIC-Bsa4 grown in LB+Kan reading at 4.8 ng/uL

Midi Prep result for pNIC-Bsa4 grown in LB+Kan reading at 4.2 ng/ul
PCR^2

Third Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Sample 1
Lane 4: Sample 2
Lane 5: Sample 3
Lane 6: Sample 4

Second Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Sample 1-Janice
Lane 4: Sample 2
Lane 5: Sample 3
Lane 6: Sample 4
Lane 7: Skipped
Lane 8: 100bp ladder
Lane 9: Sample 1- Urvashi
Lane 10: Sample 2
First Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Sample 1
Lane 4: Sample 2
Lane 5: Sample 3
Lane 6: Sample 4
Primary and Secondary PCR
Fourth Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Secondary PCR for Francisella Tularensis
Third Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Secondary PCR for Francisella Tularensis
Lane 4: Primary PCR

Second Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Primary PCR for Francisella Tularensis-Janice
Lane 4: Secondary PCR
Lane 5: Skipped
Lane 6: Skipped
Lane 7: Primary PCR- Max
Lane 8: Secondary PCR
First Attempt

Lane 1: Skipped
Lane 2: 100bp ladder
Lane 3: Primary PCR- Alex
Lane 4: Secondary PCR
Lane 5: Primary PCR- Max
Lane 6: Secondary PCR
Lane 7: Primary PCR-Janice
Lane 8: Secondary PCR
PCR results for pGFP
Fourth Attempt for pmCherry

Lane 1-Skipped
Lane 2: 100bp ladder
Lane 3: R5 (1:100000) with GFP
Lane 4: R4 (1:10000) with GFP
Lane 5: R3 (1:1000) with GFP
Lane 6: No DNA
Lane 7: R5 (1:100000) with M13
Lane 8: R4 (1:10000) with M13
Lane 9: R3(1:1000) with M13
Lane 10: No DNA

Third Attempt

Lane 1-Skipped
Lane 2: 100bp ladder
Lane 3: G5 (1:100000) with GFP
Lane 4: G4 (1:10000) with GFP
Lane 5: G3 (1:1000) with GFP
Lane 6: No DNA
Lane 7: G5 (1:100000) with M13
Lane 8: G4 (1:10000) with M13
Lane 9: G3(1:1000) with M13
Lane 10: No DNA
First Attempt


Lane 1-Skipped
Lane 2: 100bp ladder
Lane 3: G5 (1:100000) with GFP
Lane 4: G4 (1:10000) with GFP
Lane 5: G3 (1:1000) with GFP
Lane 6: No DNA
Lane 7: G5 (1:100000) with M13
Lane 8: G4 (1:10000) with M13
Lane 9: G3(1:1000) with M13
Lane 10: No DNA

PCR results
First Attempt

*My samples did not run on the gel likely since there were some delay in putting them in the PCR after adding Taq
Second Attempt

Transformation Efficiency


Plate A: 3.47ul of pGBR22 on LB-Amp plate (counted 1600 colonies)

Plate B: 1.74ul of pGBR22 on LB-Amp plate (counted 2000 colonies)

Plate C: 4.34ul of pGBR22 on LB-Amp plate (counted 4000 colonies)
Restriction Enzyme Digest

Quantifying DNA using Nanodrop (pGBR22-purple protein)

Trial #1
260/280: 1.88
260/230: 2.30

Trial #2
260/280: 1.96
260/230: 2.53

Average of Trial 1 & 2
260/280: 1.92
260.230: 2.415

Primer Sequence for 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Francisella Tularensis subsp. Tularensis)
http://helixweb.nih.gov/tmp/dnaworks_1338926014p1697_2055/LOGFILE.txt

DNA Sequencing Result
061212 - So, Janice - this is DNA sequencing result of what plasmid? --Dr. B
Forward:

AANNNNNNNNNNNNGTGNNNANNNANNCACGCNNTCCNTCNNCGCGNCNNNGGNNCTCTCNNNTGNTNNNTTTGNNNNNN
NNNGGNNNNNGCTNNGNNGATTGAAAGAGAAATATCTCANGTGTGANTCNNGTGCNTGCTCTGTTGGGGNGCTGTCNNNN
GNNGGGTCNCTAAAGGANNATCCTGCGGANTTCNNNGGNGNTTNNTNNNTTTANNNNNNGNANNNNANNANGACNATNAN
NNCCNNCCTCNANGGNNNNCNGCNNCTTANNTGNNATCNATNNTTATNNCNAACCCAANATNCATTCCTTCCNNCAACNN
TTGNTNNGTANNCNNNGNTNNTNATNTNCANNNNNNGTTCTTGNNNGANANANGTANNNNNGAAATTNTNACTTANTNNA
AANACNGGNNNNNNTNNNNNCNATGANNNNANNNNTCCNGNNNNNNNNNTCNNCTATGANNTAATNANNNGNGNNCNGNN
ANATNNNCTNNNATGGANNNCNNNNNNNANGAAGNNNNNNNNNNGGGANNNNNNNNTNNNNNNGNNNNNNNCNATTNNNT
TNNNGATANNNNANTCTTTANNAACNTTGAAGGAGGANNNATGATGTNACNNNNTNNNNNANTCTTACNNGCTNNNAAGC
NNGNTAGGTNNNCACNNNNNNNNTACTGANNNNNNNNNNTATAANGNNTNNNANNNNNACNCANNNNNTAGANNANTGTG
NATTAACNNANNTNTCAANNNNNNCCNCNNTTGCNCNCNCNATNNNCNTCANNNNNCNNCCCTNNCGANCGNNNGNGGNC
ACNNCGCANNCNNTGNCGNGNATAATGNNNACNNTNNANTNNNNTNNNANNTTNGNNNGNNNNNNNNCTGNNNANNNNNC
CNNNGGTNNANNANNTNNTNNAANNNNNNNNTNCTCCNCCNTNTNCNNNNNNNNCCTTCCCCCNNNNGGNNCNNNNNNNN
NNNNNTCCNNNNGNNTANNNNNNNTANANNNNNGGGACGCTTNNNNNNCNNNNNNTNNCCCNGGAAGNNGNACNGGGNAA
GGNNNNTNNNGNAGNNGGNNNNNTATNNNNNNNGNNTNNNNTNNNNTNN

Reverse:

NNNNNNNNNNNGANNATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGG
CCGCACTAGTGATTTTGATTGATTGAAGGAGAAATATCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATG
TCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGAAAGCCTTACGAGGGGGAGCAGACGGTAAA
GCTCACTGTCACCAAGGGTGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACTGTCTCAATACGGAAGCATACCAT
TCACCAAGTACCCTGAAGACATCCCTGATTATGTAAAGCAGTCATTCCCTGAGGGATATACATGGGAGAGGATCATGAAC
TTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACAATGTCAAAATCTC
TGGTGTGAACTTTCCTCCCAATGGACCTGTTATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTG
CACGAGATGGAATGCTGATAGGAAACAACTTTATGGCTCTGAAGTTGGAAGGAGGTGGTTACTATTTGTGTGAATTCAAA
TCTACTTACAAGGCAAAGAAGCCTGTGAGGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAGTCACAA
CAAGGATTACACATTTGTTGAGCAGTGTGAAATATCCATTGCACGCCACTCTTTGCTCGGTCATCACCATCACCATCACT
AAAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCNGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACT
GGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGNGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG
CCAGCTGGCGTAATAGCGANANGCCCGCANCGATCGCCCTTCCCANANTNCNCANCTNNNGNNATGNNNCNCCNGNANNG
NNNATNNCNNGGCGGGGNNNGGNNNNNCNNNCANCGNGNCNNTANNNNNCNGNNNCNANCNNNNNNNTNNNTNNNNNNNN
NNNNGCNNNGTNNCNNNTNNNNNNNNNNNNNNNNGGGNNNCNNNNNGNNNNANTNNNNTNNNGNNNNNGANNNNNNNNNN
NNNNNNNNNNNGGNNTNNNNNNNNAACNNTTNCNN